INTRODUCTION

The release of contaminants into the environ ment is one of the main causes of damage to the biosphere. Most of these compounds are intro duced gradually due to the increase in human activities, such as agriculture, food industry and mining. These anthropologic forces pose a threat to the health of flora, fauna and humans through the disposal of waste waters, soil contaminants, and release of toxic gasses into the atmosphere (^{Checa-Vizcaino et al., 2016}). At present, special efforts are being made to develop new methods and technologies that can be applied to con taminated soil, water and air in order to reduce negative ecological and environmental effects re sulting from human activities (^{Khan et al., 2004}; ^{Onwubuya et al., 2009}; ^{Desai et al., 2010}; ^{Gill et al., 2014}).

Olive-mill solid waste (OMSW), tomato pom ace (TP) and grape pomace (GP) are three import ant food manufacturing wastes (FMWs) from the Region of Maule, Chile. OMSW is a by-product waste produced from olive oil elaboration by a two-phase centrifugation system. The chemical characterization of OMSW has been determined, showing that it has a high moisture content, a slightly acidic pH and a high content of organic matter, mainly composed of lignin, hemicellu-loses and cellulose (the so-called lignocellulose complex); it also presents a high fat content and hydrosolubles polyphenols. Due to its antimicro bial and phytotoxic properties, OMSW has been described as a severe contaminant for soil and rivers if not properly disposed (^{Alburquerque et al., 2004}; ^{Rubio-Senent et al., 2013}). On the other hand, TP is a by-product of tomato mainly con sisting of peels and seeds, which is rich in fiber, sugars, proteins, pectins, minerals and fats (^{Del Valle et al., 2006}), while GP is mainly composed of pectins, glucans, alcohol, phenols and flavonoids (^{Baydar et al., 2007}; ^{Deng et al., 2011}; Fon tana et al., 2013).

As above mentioned, FMWs mainly consist of a mixture of polymers, which are composed of cellulose, lignin, pectin and hemicellulose. Cellu lose is a homopolimer composed of glucose units; lignin is a polyphenol whose main monomer is p-hidroxiphenylpropane; and pectin is a poly mer comprised of p-D-galacturonic acid. Finally, hemicellulose corresponds to the fraction from lignocellulose, which is removed by alkali and is composed by a mixture of complex heteropoly-mers of xylan, galactan, mannan and arabinan. The strength of the cell wall is established by the presence of several types of interactions between these polymers. In this way, hemicellulose inter acts with cellulose by means of hydrogen bonds, while lignin interacts by means of eter or ester co-valent bonds (^{Pérez et al., 2002}).

In nature, a wide range of fungal strains are capable of using FMWs as sole carbon source. These fungal strains secrete a wide range of en zymes with hydrolytic potential that can de grade complex polymers of sugars, such as those present in the cell wall (^{Sanchez, 2009}). Fungal enzymes from Penicillium purpurogenum, Neuros-pora crassa and Mucor sp. have been used in the degradation of coffee silverskin and spent coffee grounds generated by the coffee industry, result ing in a higher release of phenolic compounds that can be applied either in the pharmaceutical or food industries (^{Machado et al., 2012}). Pleuro-tus ostreatus has been used to degrade TP for the production of laccase enzyme (^{Freixo et al., 2012}). In addition, the same substrate has been used to produce xylanase by Aspergillus awamori (^{Umsza-Guez et al., 2011}).

The objective of this work was to isolate a fun gal strain capable of growing on food manufac turing wastes (FMW) in order to generate future strategies for the disposal of FMWs in the Region of Maule, Chile.

MATERIALS AND METHODS

Chemicals. From Merck (Darmstadt, Germany): (NH₄)₂SO₄, KH₂PO₄, MgSO₄, FeSO₄ x 7H₂O, isopropanol, chloroform. From Phytotechnology Laboratories (Kansas, USA): CaCl₂, ZnSO₄, CoCl₂, MnSO₄. From Promega (Madison, USA): Urea. From Becton, Dickinson and Company: Neopep-tone, Potato Dextrose Agar. From Sigma-Aldrich (Missouri, USA): Gallic acid, Folin-Ciocalteu re agent and glucose.

Fungal strain and culture conditions. A fungal strain was isolated from tomato and kept refrig erated at 4°C for at least one week. Tomato skins were cut into small pieces, placed on the surface of a potato dextrose agar plate (PDA) and kept at 28°C in an incubator. After seven days, small piec es of agar containing fungi were extracted from the edge of the mycelium and placed on the cen ter of a new PDA plate. Plates were incubated for 7 days at 28°C. This procedure was repeated two more times until homogeneous colony formation. After the agar plate was fully covered with my celium, dark sclerotia were formed. The fungal slide culture procedure was used for mycelium staining. Briefly, a plug of a PDA plate of 0.4 mm² was placed on a glass slide. Mycelium was placed on the plug and covered with a microscope cover-slip. After mycelial growth on the PDA plug and attachment on the coverslip occurred, mycelia was carefully removed and stained with a solu tion of lactophenol cotton blue, and then observed using an optical microscope (Optika, Italy). Liq uid cultures were performed in Mandel's medi um as previously described (^{Ravanal et al., 2013}). Four agar plates containing the mycelium were scraped using an inoculation loop. The mycelium was dissolved in an Erlenmeyer flask containing a sterile 0.9% NaCl solution and glass beads to fa cilitate spore release. After shaking, this solution was filtered using sterile dressing. Spores were counted in a Petroff-Hauser chamber and 4 x 10⁶ were inoculated in 100 mL of Mandel's medium supplemented with FMWs at 0.5% as the only carbon source. For solid medium experiments, 0.6 mm² of a PDA plug containing the mycelium were extracted and placed on the surface of the plates containing Mandel's medium containing

4% of agar (Difco) and the FMWs at 0.5%.

Strain identification. Mycelium was resuspend-ed in 1 mL of modified Buffer A and then lysed in Precellys® 24 (Bertin, France) using beads of 0.5 mm. After lysis, tubes were centrifuged at 11,000 rpm for 10 min at 4°C. Then the super natant was transferred to a clean tube and an equal volume of isopropanol was added. Tubes were kept at -20°C overnight. Samples were centrifuged at 12,000 rpm for 10 min at 4°C and the supernatant was discarded. Samples were dried at room temperature and then resuspended in Milli Q water. DNA was purified with 1 volume of phenol/chloroform and centrifuged at 11,000 rpm for 5 min at 4°C. Then, 2.5 volumes of cold ethanol were added and then kept overnight at -20°C. DNA was washed with ethanol 70% and dried at room temperature. DNA was resuspend-ed in MQ water and then stored at -20°C. Finally, it was quantified using Nanodrop 2000 (Thermo Scientific, Delaware, USA) and visualized using agarose 1% gel electrophoresis. Aliquots were used in PCR reactions using primers ITS-1 (5'TCC GTAGGTGAACCTGCGG 3') and ITS-4 (5' TCCTCCGCTTATTGATATGC 3'). An aliquot of this PCR reaction was sequenced using the same primers (Macrogen, Korea)(^{Cáceres et al., 2012}).

The obtained sequence was compared with all sequences from GenBank using the BLAST alghoritm (Megablast) (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Bioedit software was used for mul tiple alignments and edition of selected sequenc es. Phylogenetic analyses were carried out using Mega 7. The phylogenetic tree was constructed using the Neighbor-joining method. This method was used to infer the evolutionary history of the isolates, while the bootstrap consensus tree was inferred from 100 replicates. There were 405 and 184 positions in the final dataset. Botrytis genera were used as the outgroup (^{Kumar et al., 2016}).

Residue preparation. FMWs were dried at 60°C in a hot plate for at least 24 hours avoiding burn ing. Subsequently, they were ground in a crush ing machine and sieved in a 300 mm mesh (VWR, Pennsylvania, USA). This material was used at 0.5% as the carbon source for liquid and solid me dium experiments (^{Sanchez C., 2009}).

Analytical methods. Mycelium radial growth was monitored by measuring the colony diame ter every 24 hours. The total content of phenolic compounds in the supernatant of the culture was measured using the Folin-Ciocalteu reagent, us ing gallic acid as standard. Total carbohydrates were measured using the Dubois method using glucose as standard (^{Valenzuela et al., 2015}). A volume of 500 |jL of culture supernatants was used in both methods. However, a volume of 500 |jL of 1/10 dilution was used for total sugar anal ysis in the case of Mandel's medium supplement ed with glucose.

RESULTS AND DISCUSSION

In order to evaluate the degradation of FMWs, a fungal strain was isolated from decomposed to mato kept in the refrigerator. The fungal strain was grown in PDA plates for seven days, until it completely covered the Petri plate. Black sclerot ic bodies were observed 9-10 days after (Fig. 1A). Microscope observations of mycelium samples stained with lactophenol cotton blue showed the formation of branching tree-like conidiophores and ovoidal conidia. Besides, the hyphae was of a segmented type (Fig. 1B). Inoculation of fungi on raspberry, grape wine and spinach leaves showed dark rings after 5 days of inoculation (data not shown). PCR amplification using ITS-1 and ITS-4 primers using the DNA of the mycelium grown on LB media produced a DNA amplification fragment of around 570 pb. This fragment was sequenced using the ITS primers. Partial DNA sequence using ITS-1 showed a sequence similar to (100% identity) Botrytis cinerea strain ATCC 11542 (Genbank: KU729081.1). The analysis of partial sequence of strain T1 showed that this mi croorganism is closely related to phytopathogens as Botrytis and Alternaria genera (Fig. 1C). Both genera are widely recognized as a cause of severe losses in agriculture. This identification agrees with the morphology of mycelia and the patho genic behavior of this kind of strains on different biotic surfaces (see above).

After DNA characterization, strain T1 was grown on Mandel's medium supplemented with FMWs. Glucose was added to the liquid cultures and plates for comparison purposes. On plates, strain T1 was capable of growing on the three FMWs. However, the maximum radius at 96 hours was observed on OMSW (3.6 cm), followed by GP (3.2 cm) and TP (2.8 cm) (Fig. 2A). Cultures were incubated at 24°C and the total biomass (wet weight) obtained after nine days of culture was 5.6 g for OMSW, 1.9 g for GP, and 1.4 g for TP. It is important to note that, although OMSW waste has been referred to as having antimicrobi al properties, the visual inspection of OMSW cul tures after 10 days of inoculation revealed almost complete degradation (data not shown). Con versely, GP and TP did not seem to be rich carbon sources for strain T1. Future research is required to determine if the low growth observed in GP and TP wastes, as compared to that in OMSW, could be due to antifungal properties released during metabolization.

To evaluate the metabolization of total sugars after inoculation with strain T1, total carbohydrate content was analyzed from culture supernatants. The total sugar content reached the highest values in OMSW, which decayed on the first day, keeping constant levels after three days of culture. In the GP culture, total sugars decreased after four days of inoculation reaching similar levels to those ob served in OMSW cultures. In contrast, almost no changes were found in TP cultures. In the glucose cultures, 1/10 dilution of supernatants decreased sugar content on the fourth day (Fig. 2B). These results suggest the presence of metabolic activity possibly due to extracellular enzymes produced by strain T1 (^{Espino et al., 2010}; ^{González-Fernández et al., 2014}). Similarly, total phenolic compounds were measured after inoculation with strain T1. High values of total phenolic compounds were found in OMSW, which decayed after one day of inoculation and reached constant levels on the fifth day. Similar behavior was found in the GP su pernatant, but constant levels were reached on the third day. In contrast, supernatants of TP cultures were almost depleted on phenolic compounds. As expected, residual values were observed in Mandel's medium supplemented with glucose. Those values could be due to the presence of phe nolic compounds in Mandel's medium since this contains neopeptone. These results suggest the presence of mechanisms to degrade or transform phenolic compounds from the culture medium present on OMSW and GP cultures (^{Schouten et al., 2002}). It is known that strain T1 secretes laccases that could be responsible for phenolic compounds oxidation (Espino et al., 2010; González-Fernández et al., 2014) (Fig. 2C). These results indicate that mesophilic fungi can be used to degrade FMWs in order to eliminate this kind of waste from the environment.

Fig. 1 Morphology and molecular analysis of strain T1. A. Mycelium from strain T1 grown on a PDA plate showing dark sclerotia. B. A sample taken from a mycelium grown on PDA plate and stained with lactophenol blue. Sample was observed under 40 X microscope. Bar indicates 20 mm. Dark arrows indicate septa on hypha. Observe the tree-like conidiophores presenting ovoidal conidia. C. Neighbor joining tree of the strain T1 (bold letters), using ITS1 spacer DNA. The results show the relationship of 13 sequences of different fungus genera obtained from GenBank and Botrytis genera as outgroup. The bootstraps value obtained from 100 repli cates were shown in each node. Scale bar represents 0.05 substitution per nucleotide position. 

Fig. 2 Growth of strain T1 on food manufacturing wastes. A. Radial growth of strain T1 on agar plates containing Mandel's medium supplemented with glucose (G), OMSW (A), TP (T) and GP (U). Error bars indicate the SDs based on three different replicated experimental values. Numbers on top of each bar indicate the relative radius corresponding to mycelial growth. B. Analysis of total sugars from the supernatant of strain T1 grown in different carbon sources. C. Analysis of total phenolic compounds from the culture supernatant of strain T1 grown in different carbon sources. Squares: Mandel's medium supplemented with OMSW. Cross: Mandel's medium supplemented with GP. Triangle: Mandel's medium supplemented with TP. Diamonds: Mandel's medium supplemented with glucose. OMSW: olive mill solid wastes; TP: tomato pomace; GP: grape pomace. 

CONCLUSIONS

The results show that strain T1 degrades olive mill solid wastes more efficiently (OMSW) than grape pomace (GP) and tomato pomace (TP). The physiological adaptations of strain T1 when used in food manufacturing wastes (FMW) (i.e. chang es in protein expresion), and the adjustment of the parameters of the biodegradation should be studied in order to improve the biodegradation of these three residues, particularly GP and TP wastes, and eventually eliminate them from to environment.